DNA barcoding of samples
- Place sample in a clean 1.5 mL
- Add 100 μl of nuclear lysis solution to tube.
- Twist a clean plastic pestle against the inner surface
- Add 500 μl more nuclear lysis solution to tube.
- Incubate the tube in a water bath or heat block at 65°C for 15 minutes.
- Add 200 μl of protein precipitation solution to each tube incubate
on ice for 5 minutes - Centrifuge for 4 minutes at maximum speed to pellet protein and cell debris
- Transfer 600 μl of supernatant to a clean labeled tube.
- Add 600 μl of isopropanol
- Centrifuge for 2 minute at maximum speed to pellet the DNA.
- Pour off the supernatant and add 600 μl of 70% ethanol to wash the pellet
- Centrifuge the tube for 2 minute at maximum speed and carefully remove the solution
- Air dry the pellet for 10 minutes and add 100 μl of the DNA rehydration solution (TE)
- Incubate the DNA at 65°C for 5-10 minutes to dissolve
- Obtain PCR tube containing Ready-To-Go PCR Bead. Label the tube with your
identification number. - Use a micropipette with a fresh tip to add 23 μL of one of the following
primer/loading dye mixes to each tube. Allow the beads to dissolve for 1 minute.
- Plants: rbcL primers (rbcLaF / rbcLa rev)
- Fish: COI primers (VF2_t1/ FishF2_t1/ FishR2_t1/ FR1d_t1)
- Insects: (LepF1_t1/ LepR1_t1)
- Add 2 μl of your DNA directly into the appropriate primer/loading dye mix.
- Place tubes in a Thermal cycler
- Pour 2% agarose into casting apparatus in refrigerator
- 2 gel per class need to be made → 100ml of TBE with 2g agarose
- add 5 μl SYBR safe solution into the molten agarose before casting
- place 2 sets of combs into the gel → at one end and in the middle
- Load DNA ladder and PCR samples
- Run gel at 120V for 30 minutes
- Visualize on UV transilluminator
- Document with camera
- Send amplicons of verified samples for sequencing
- Plant rbcL gene
- rbcLaf 5’- ATGTCACCACAAACAGAGACTAAAGC-3’ (forward primer)
- rbcLar 5’- GTAAAATCAAGTCCACCRCG-3’ (reverse primer)
- Animal coi gene
- lepF1 5’- ATTCAACCAATCATAAAGATATTGG -3’ (forward primer)
- lepR1 5’- TAAACTTCTGGATGTCCAAAAAATCA-3’(reverse primer)
- vf1f 5’- TCTCAACCAACCACAAAGACATTGG-3’ (forward primer)
- vf1r 5’- TAGACTTCTGGGTGGCCAAAGAATCA-3’ (reverse primer)

